rabbit anti cavin 3 polyclonal (Proteintech)

Proteintech is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Proteintech rabbit anti cavin 3 polyclonal

Rabbit Anti Cavin 3 Polyclonal, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1746 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+anti+cavin+3/GKN2+Antibody/pmc05716666-19-2-6
Average 96 stars, based on 1746 article reviews

rabbit anti cavin 3 polyclonal - by Bioz Stars, 2026-09

96/100 stars

Images

1) Product Images from "Deciphering caveolar functions by syndapin III KO-mediated impairment of caveolar invagination"

Article Title: Deciphering caveolar functions by syndapin III KO-mediated impairment of caveolar invagination

Journal: eLife

doi: 10.7554/eLife.29854

Figure Legend Snippet:

Techniques Used: Transfection, Construct, Western Blot, Recombinant, Plasmid Preparation, Software, Staining

Protease Inhibitor:

Article Title: Endocytic Crosstalk: Cavins, Caveolins, and Caveolae Regulate Clathrin-Independent Endocytosis
Article Snippet: .. Mouse anti-CD44 (clone 5035-41.1D, Novus Biologicals), rabbit anti-CAV1 (BD Biosciences), rabbit anti-Caveolin2 (Sigma Aldrich), rabbit anti-Cavin-1 and Cavin-4 antibody were raised as described previously , rabbit anti-Cavin-3 (ProteinTech group), mouse anti-Cavin-2 (Sigma Aldrich), rabbit anti-HA (Sigma Aldrich), mouse anti-Cdc42 (Becton Dickinson), mouse anti-GFP (Roche), mouse anti-transferrin receptor antibody (Zymed), Alexa Fluor conjugated dextran (Life Technologies), anti-rabbit and anti-mouse Alexa Fluor antibodies (Invitrogen), Alexa Fluor conjugated transferrin (Invitrogen), Alexa Fluor conjugated phalloidin (Invitrogen), Filipin III (Sigma Aldrich), Dynasore (Sigma Aldrich), 7-Ketocholesterol (Sigma Aldrich), Protease Inhibitor Cocktail Set III (Merck Millipore), PhosSTOP Phosphatase Inhibitor Cocktail (Roche), Dyngo-4a (Sigma). .. Stealth RNAi siRNA duplex oligonucleotides targeted against mouse Cavin-1 ( 5′CCGCUGUCUACAAGGUGCCGCCUUU3′ ; 5′AAAGGCGGCACCUUGUAGACAGCGG3′ ) and Cavin-3 ( 5′CCGGAGCUCUGAAGGCCCAUCAGAA3′ ; 5′UUCUGAUGGGCCUUCAGAGCUCCGG3′ ) (Invitrogen).

Article Title: Endocytic crosstalk: cavins, caveolins, and caveolae regulate clathrin-independent endocytosis.
Article Snippet: .. Antibodies and Reagents Mouse anti-CD44 (clone 5035-41.1D, Novus Biologicals), rabbit anti-CAV1 (BD Biosciences), rabbit anti-Caveolin2 (Sigma Aldrich), rabbit anti-Cavin-1 and Cavin-4 antibody were raised as described previously [16], rabbit anti-Cavin-3 (ProteinTech group), mouse anti-Cavin-2 (Sigma Aldrich), rabbit anti-HA (Sigma Aldrich), mouse anti-Cdc42 (Becton Dickinson), mouse anti-GFP (Roche), mouse anti-transferrin receptor antibody (Zymed), Alexa Fluor conjugated dextran (Life Technologies), anti-rabbit and anti-mouse Alexa Fluor antibodies (Invitrogen), Alexa Fluor conjugated transferrin (Invitrogen), Alexa Fluor conjugated phalloidin (Invitrogen), Filipin III (Sigma Aldrich), Dynasore (Sigma Aldrich), 7-Ketocholesterol (Sigma Aldrich), Protease Inhibitor Cocktail Set III (Merck Millipore), PhosSTOP Phosphatase Inhibitor Cocktail (Roche), Dyngo-4a (Sigma). .. Stealth RNAi siRNA duplex oligonucleotides targeted against mouse Cavin-1 (59CCGCUGUCUACAAGGUGCCGCCUUU39;59AAAGGCGGCACCUUGUAGACAGCGG39) and Cavin-3 (59CCGGAGCUCUGAAGGCCCAUCAGAA39; 59UUCUGAUGGGCCUUCAGAGCUCCGG39) (Invitrogen).

Incubation:

Article Title: Cavin-3 (PRKCDBP) deficiency reduces the density of caveolae in smooth muscle
Article Snippet: .. The primary antibody used was rabbit anti-cavin-3 (16250-1-AP, ProteinTech group, Chicago, Ill., USA) and sections were subsequently rinsed (2 × 10 min) in PBS with 0.25% Triton X-100 followed by incubation with secondary antibody. ..

Review

rabbit anti cavin 3 polyclonal (Proteintech)

Structured Review

Images

1) Product Images from "Deciphering caveolar functions by syndapin III KO-mediated impairment of caveolar invagination"

Related Articles

Protease Inhibitor:

Incubation:

Similar Products

Image Search Results